Suggested problems

Learn About How To Contact The Cash App To Receive a Cash App refund?

March 16, 2021, 10:40 a.m. by will smith

Biological Motivation

Cash app refund you may have the chance to cancel a payment if the recipient has not accepted it. For automated instructions over the phone, call 855-351-2274. Please note that there are currently no financial assistance phone numbers available. To request contact via cash.app/help: Scroll down and click "Contact Support" below. Log in. Look for your problem. Click Contact Support. https://www.contactsupport-number.com/blog/how-to-refund-on-cash-app/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21