Suggested problems

For inline math

March 15, 2021, 2:36 a.m. by australiaescortshuba

Biological Motivation

For inline math, enclose the LaTeX syntax in dollar signs ($). For displayed math, enclose the syntax with two dollar signs ($$).

Problem

cheap escorts

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21