March 15, 2021, 2:36 a.m. by australiaescortshuba
Biological Motivation
For inline math, enclose the LaTeX syntax in dollar signs (
$). For displayed math, enclose the syntax with two dollar signs ($ $).
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21