Suggested problems

Spa and all type of Services

March 12, 2021, 8:49 a.m. by kajal varma

Biological Motivation

Call Girl in Noida service is 24x7 available at kajalVerma escort. You can find Independent escort, housewife, cheap call girl in all sector. https://www.kajalvermas.com/escort-service-in-noida/

https://www.kajalvermas.com/escort-service-in-ghaziabad/

https://www.kajalvermas.com/escort-service-in-meerut/

Problem

https://www.kajalvermas.com/escort-service-in-noida/

https://www.kajalvermas.com/escort-service-in-ghaziabad/

https://www.kajalvermas.com/escort-service-in-meerut/

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21