Suggested problems

Buy All Pills Online | Tramadol 50mg, Adderall | Ambien 10mg Order Medicine Online | Overnight Shipping | Cheap & Affordable

March 11, 2021, 11:26 a.m. by ambien10mg

Biological Motivation

..[Buy Ambien10mg Online overnight][1] delivery by saving your money and time. We handle everything from online evaluation to delivery of treatment & free ongoing care for Insomnia, [Erectile Dysfunction & more][2].

[1]: https://ambien10mg.com [2]: https://ambien10mg.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21