Suggested problems

Buy cenforce 200 online with the best price

March 10, 2021, noon by Jaime_Corbett

Biological Motivation

Erectile dysfunction is a disorder in which men fail to achieve a hard erection for lovemaking and there is only one cure for this failure and that is cenforce 200. To overcome a sexual problem like erectile dysfunction, take cenforce medicine half an hour before sexual intercourse and enjoy the sexual pleasures of life with your partner.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21