Suggested problems

Learn easy methods to fix Cash app won't let me send money issue:

March 10, 2021, 5:26 a.m. by James Thomas

Biological Motivation

If the Cash app won't let me send money then I might have entered the wrong details of the recipients. We suggest users recheck the recipient's details and try again to send money. Also, connect your device to the Wi-Fi or router connection for uninterrupted performance. Apart from this, make sure to update and restart the application in case you are facing the issue even after connecting the device to the internet.

https://www.email-contactsupport.com/blog/cash-app-wont-let-me-send-money

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21