Suggested problems

ventura escape rooms

March 6, 2021, 1:38 p.m. by escaperoom

Biological Motivation

Do you wish to be a superhero? Visit the [Ventura escape rooms][1] to jump into the shoes of a hero! The escape companies offer rooms with different themes at various prices. The incredible stories with unpredictable twists and turns provide a thrilling experience that will leave you wide-eyed. It is the perfect idea to organize a unique party that everyone would remember forever. Anything may change in the blink of an eye, so be on alert to escape from the room!

Are you longing for a fun-filled weekend in Ventura? Escape rooms may meet your wish. Quick!! Visit Ventura Escape Rooms now for the ultimate thrill !!

[1]: https://escaperoom.com/venue/the-ultimate-escape-rooms-ventura-ca-usa

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21