Suggested problems

IIOT and Several Different Industrial Automation Application

March 2, 2021, 12:33 p.m. by elizagracee

Biological Motivation

What One Understands By IIoT? This usually stands for interconnected sensors and also other devices alongside instruments which work alongside each other. It helps with remote monitoring but the most crucial factor would be data acquisition and also data analysis. With data collection and analysis, [IIoT is now the vital way how the industry works][1]. With the fast implementation and low cost, they offer high productivity and also efficiency. And, here are several applications of IIoT in industrial automation.

Label Printers Avoid Running Out Of Paper When it comes to the packaging industry or the logistic department, the running of labels could cause quite a ruckus. To prevent the situation, the technicians should be intimated before so that they could up on it and avoid such situations. To prevent stagnation, IIoT helps as the sensor’s data gives a triggering warning and an email notification or a push notification reaches the designated device.

Publishing New Functionalities on HMI Screen When it comes to one’s customer, they might be receiving equipment which would make their life quite easy but might want some new functionalities. An expansion in controls will be the perfect solution and that could easily be fixed with the guidance of the programmer. But keep in mind that the HMI software would require a periodical update and tested so that the new functionality could be launched.

Helps with Machine Maintenance and Replacement Have you ever thought how if you knew that some part of your machine would be breaking down and by taking care of it beforehand, you would be increasing productivity? Also, wasting no time and might even save a lot by avoiding a bigger situation. This is what IIoT offers with predictive maintenance. On-site machine maintenance is a great way to ensure there are no faults later on. By analyzing the problems, you will be saving yourself from a lot of hassle.

Optimized Industrial Robot Actions UR+ robots are known to make repetitive work a lot easier. With video analysis, you would be able to improvise the action of a certain robot and get better insights on log files. Also, with a VPN connection, you could establish a more stable, secure, and safe connection with any device that is connected to the robot and access it from anywhere.

One with IIoT could also manage multiple data with central monitoring from multiple buildings. Therefore, the benefits that one gets to enjoy with industrial IIoT are several and one would have complete control with safe but easy access. Also, IIoT is now being used in various sectors including energy, manufacturing, robotics, and others.

[1]: https://th.cc-link.org/th/cclink/article/differences_between_fourth_and_third_industry.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21