Suggested problems

Kamagra 100

Feb. 25, 2021, 8:40 a.m. by Jaime_Corbett

Biological Motivation

Kamagra 100 drug can be used to treat erectile dysfunction among men. Drug use increases men's sexual activity which is essential for the attainment of happiness. This kamagra medicine can be taken orally or as an injection in the body as prescribed by the doctor. Heart and kidney patients are also not allowed to use kamagra by a doctor so they should be careful not to use the drug.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21