Suggested problems

Make your Experience Unforgettable With Udaipur Escorts

Feb. 23, 2021, 7:17 a.m. by Top Class Genuine Escorts Service Provider in Udaipur

Biological Motivation

We offer too A romantic erotic full body massage with [Udaipur Escorts][1] is a good idea to relax in your spare time—just.Our Udaipur Escort service will release your tension and stress,I am sure you will get more than what you expect especially when your instinct reaction recalls for further intimate contact.

![enter image description here][2]

[1]: http://www.sarakaur.com/udaipur-escorts.php [2]: https://www.vikingforum.net/d3/avatars/l/10/10386.jpg?1614060236

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21