Suggested problems

how to make my facebook private

Feb. 20, 2021, 6:17 a.m. by Chime Direct Deposit

Biological Motivation

People who use Facebook they could be seen asking how to recover deleted Facebook message. Here is the answer to this burning question. If you have enabled the archived feature on Facebook and created a back of your messages, you have a reason of smile. And the reason of smile is that you certainly can recover your lost or missing message. Here is more information about how to recover deleted Facebook messages. If someone of you wants to keep privacy intact on Facebook, just check out this helping post- [how to make my Facebook private?][1]

[1]: https://quickutilities.net/blog/facebook-profile-picture

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21