Suggested problems

Fildena

Feb. 19, 2021, 11:07 a.m. by Jaime_Corbett

Biological Motivation

The most common and widely used drug for sexual dysfunction is fildena. This drug also treats the pulmonary problem of hypertension along with the treatment of ED. But the only thing about this drug is that it is activated only at the time of sexual arousal. Buy fildena from a reliable pharmacy certifiedmedicine.com and get up to 30% off on the price of the drug. Mention below are other ED tablets: Fildena 100, Fildena 150

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21