Suggested problems

Cockatoos For sale

Feb. 10, 2021, 9:07 p.m. by cockatoos

Biological Motivation

We are professional breeders.We have Cockatoos For sale,Cockatoo Parrots For Sale,Blue And Gold Macaws For Sale,African Grey Parrots For Sale,Hyacinth Macaws For Sale,Green Wing Macaws For Sale,Scarlet Macaws For Sale,Toucans For Sale.

http://cockatoo.company.com/

Cockatoos For sale,Cockatoo Parrots For Sale,Blue And Gold Macaws For Sale,African Grey Parrots For Sale,Hyacinth Macaws For Sale,Green Wing Macaws For Sale,Scarlet Macaws For Sale,Toucans For Sale,

http://cockatoo.company.com/about.html http://cockatoo.company.com/contact.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21