Suggested problems

How Do I Sign-In to Cox webmail account?

Feb. 6, 2021, 11:08 a.m. by Henry Max

Biological Motivation

Cox is one of the largest email service providers, and you can send and receive emails, handle spam messages and can access the device easily. While using it, many users face [Cox webmail login email Problems][1], and it can be fixed by

 Open the email account and sign-in to the Cox email.  Type the user ID and password in the required fields.  After that you have to Sign In and can access your email account.

However if still getting any [Cox. Webmail login][2] issues or any other issue related to Cox such as: Why is Cox email down today? You can reach the experts and get all your issue fixed instantly by taking their help.

Related Post [Cox email not receiving emails][3]

[1]: https://contactemail.us/cox-email-sign-in/ [2]: https://contactemail.us/cox-email-not-working-problems/ [3]: https://contactemail.us/how-to-troubleshoot-cox-mail-account-not-sending-receiving-emails/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21