Suggested problems

www.trendmicro.com/bestbuypc

Feb. 4, 2021, 9:52 a.m. by trendmicro

Biological Motivation

...download trend micro Antivirus through www trendmicro com/besbuypc. and then install it. It is a user-friendly platform where you can easily purchase and download the subscribed Trendmicro products. at TrendMicro com besbuypc you can take advantage of various features of TrendMicro. The online and offline threats are always looking for the device which is weakened and not having an antivirus program. If once threats inject on the device, it starts slowing down the device, lost the files, and created many issues. trend micro Antivirus safeguards the device from all these kinds of problems.

[1]: https://www-trendmicro.com/bestbuypc

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21