Suggested problems

123.hp.com/setup

Feb. 4, 2021, 9:42 a.m. by 123.hp.com/setup

Biological Motivation

Download and install HP Printer driver software for HP printer setup. Before scanning documents to your computer using a 123hpcom/setup scanner, you need to install a printer scanner driver so that your printer scanner and computers can interact with you. Start by connecting the printer setup scanner to your USB port computers.

[1]: https://s-123hp.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21