Feb. 4, 2021, 6:39 a.m. by daynightlove
Biological Motivation
If you love to date women and are excited about making new friends, then hire a http://daynightlove.in/call-girl-in-solan//"> Call Girl in solan. They are experts in providing companionship. They can provide you a girlfriend-like experience and can take you on the wildest tour of entertainment and pleasure with their dirtiest moves. Make sure to explain which type of service you want while booking a Call Girl.
![enter image description here][1]
[1]: http://daynightlove.in/wp-content/uploads/2020/01/7.jpeg
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21