Suggested problems

Goof in the tab the clarification for Cash App issue? Interface with Cash App customer service care.

Feb. 4, 2021, 5:24 a.m. by Akila le

Biological Motivation

A few errors in the tab may wind up being the clarification for an issue in the application and likewise to dispose of the irritating you can use the help of Cash App customer service assistance. You can in like manner find maintain from the tech consultancies or you can use the vids open on Youtube for help.

https://www.contact-mail-support.com/phone-number/square-cash

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21