Suggested problems

routerlogin.net | www.routerlogin.net | 192.168.1.1 login | Router Login

Feb. 2, 2021, 7:44 a.m. by routerlogin.net

Biological Motivation

routerlogin.net | [www.routerlogin.net][1] | 192.168.1.1 login | Router Login routerlogin.net is the web address for Netgear router setup. If you want to change your router password or update your router, open your web browser and type [www.routerlogin.net][2] in the address bar or type your default ip address i.e 192.168.1.1 We at [routerlogin.net(wwwrouterlogin-net.com)][3] offer the foremost incredible assistance for all the problems befalling routerlogin.net(wwwrouterlogin-net.com) routers and extenders. If you’re trying to configure this router together with your existing network, but face issues, then there’s nothing to stress about, as you’ll contact experts to work out the proper way of configuring the router. Call us at our toll-free number today +18018903242.

[1]: https://wwwrouterlogin-net.com/ [2]: https://wwwrouterlogin-net.com/ [3]: https://wwwrouterlogin-net.com/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21