Suggested problems

Quickbooks Database server manager

Jan. 29, 2021, 7:19 a.m. by kevinmalone231

Biological Motivation

[Quickbooks Database server manager][1] lets you share your company files with others pc over your network. It also helps to check your multi user network.when you setup network you need it running so that users can access your files. for more knowledge on same you can visit the site https://updateerror.co/quickbooks-database-server-manager/ ...

[1]: https://updateerror.co/quickbooks-database-server-manager/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21