Suggested problems

Biological Motivation

If a person suffers from erectile dysfunction and is looking for an effective drug to treat it, the drug is fildena 100 mg. This drug stimulates men to live sexual desires by resolving ED early on. This drug is taken with the help of its active ingredient sildenafil citrate to remove ED. Anyone can buy this fildena medicine from any pharmacy that sells it at low prices.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21