Suggested problems

Test Bank For Choosing Health 3rd Edition

Jan. 23, 2021, 6:41 a.m. by robin smithsters

Biological Motivation

Just to add a few words to the excellent article above, have you ever wondered where you can find the best test banks and solution manuals online? The answer to this question is just a click away. Checkout this https://testbanksonline.com/tbsm/test-bank-for-choosing-health-3rd-edition/">Test Bank For Choosing Health 3rd Edition to get an immediate A+.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21