Suggested problems

Kamagra 100

Jan. 19, 2021, 10:28 a.m. by Jaime_Corbett

Biological Motivation

The only popular and powerful medicine for the treatment of sexual dysfunction is kamagra 100. This kamagra is an effective drug that not only treats ED but also treats disorders like hypertension and hyperplasia. The active ingredient of this medicine is sildenafil citrate which is used to treat diseases related to blood flow in the body. This kamagra drug is widely popular in the world due to its guaranteed result.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21