Suggested problems

Co occurring TFBS in DAN

July 7, 2015, 6:27 p.m. by Summaira

Biological Motivation

...Transcription factor binding sites co occour usually and they control and regulate the gene expression and reguation tissue specifically.

Problem

A simple DNA string that has AGCTGATGATGATAGATNNNNNXXXXXAGCAGCAGCGACA In this string X and N 's are masked regions that dont need to be searched. Let say we have two Transcription Factors: TF1 : tgata, gctga TF2 : TAGAT, AGCCA

traget is to look up for a region in the above dna string where these two TF;s co occur, no matter which of the pattern is present.

Given: A DNA string $s$ of length at most 1000 nucleotides. 4 patterns each of 6 nt window size 18;

Return: Return the range where these 2 TF's co occour

Sample Dataset

$DNA= AGCTTTTCATTCTGACTGCAACGGGXXXXCAATATGTNNNNNNGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
@TF1 = ["TGCAT", "TATGT", "AGCA]
@TF2 = ["TTCTG", "ACGGG"]
wINDOW 14

Sample Output

Position 12 to 24 : TF1, TF2 are found (co occour)
likewise position 68 - 82 :  TF1, TF2 are found (co occour)