Suggested problems

How To Get A Printer Online?

Jan. 12, 2021, 10:30 a.m. by aleon jhon

Biological Motivation

We are one of the reliable and well-supportive HP Printer Tech-Support service providers aiming to serve quality assistance to the needy customers. There are many printer users who often found that their printer suddenly stops printing any selected document and start showing [Printer Offline error][1] message. If you are also an HP Printer users and facing the same problem, then don’t feel blue! We the top-most tech-support engineers are available round the clock for your help. We are extremely talented and have immense experience in handling technical glitches either it is tough or nasty. So, let us know if your printer is offline we will direct you How To Get A Printer Online back in a very short span of time. We are specialized offering the best effectual solutions to any kind of printer related problems. It is also the fact that there are numerous online organizations deceptive individuals with interesting offers and not conveying items to their desires. This makes it tough for individuals to decide and trust what they see on the web. Despite this terrible reality, a lot of people are deciding to investigate various online alternatives and hence we are at their priority list. We have earned loads of love from our customers because they get satisfaction solution in a less time of interval. Hence, feel free to connect us through helpline accessible number and get solution remotely.

[1]: https://sites.google.com/view/why-is-my-hp-printer-offline/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21