Suggested problems

Cenforce 100 review

Jan. 11, 2021, 10:03 a.m. by Jaime_Corbett

Biological Motivation

Cenforce is a well-known drug that is widely used to treat erectile dysfunction in men, a common erotic complaint in men. This drug enhances the blood supply to the penile region and provides a strong erection to achieve sexual pleasure. Got good cenforce 100 review from most users.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21