Suggested problems

best pay per click advertising companies

Jan. 8, 2021, 9:47 a.m. by Reflekt Visual

Biological Motivation

In order for ads to appear alongside the results on a search engine (commonly referred to as a Search Engine Results Page, or SERP), advertisers cannot simply pay more to ensure that their ads appear more prominent than their competitor’s ads. Instead, ads are subject to what is known as the Ad Auction, an entirely automated process that Google and other major search engines use to determine the relevance and validity of advertisements that appear on their SERPs. There is the [best pay per click advertising companies][1] that will provide complete strategies before the campaign

...

[1]: https://www.reflektvisual.com/pay-per-click-advertising-services/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21