Suggested problems

best pay per click advertising companies

Jan. 7, 2021, 12:27 p.m. by Reflekt Visual

Biological Motivation

Pay per click marketing provides you with laser-targeted visibility, which speeds up the customers’ buying journey and boosts your conversion rate. There is a [best pay per click advertising companies][1] which will provide perfect ppc services packages.

[1]: https://www.reflektvisual.com/pay-per-click-advertising-services/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21