Suggested problems

Philippine Airlines Booking Tickets

Jan. 6, 2021, 10:40 a.m. by John Cena

Biological Motivation

Every Philippine Airlines flight ticket has its own free [Philippine Airlines baggage allowance][1]. Travelers are prescribed not to convey adornments, valuable metal, flatware, debatable papers, protections, and other important in their registered baggage. Call Now +1-844-915-2138

[1]: https://www.thecustomerservicenumber.com/philippine-airlines-reservations/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21