Jan. 4, 2021, 9:45 a.m. by Reflekt Visual
Biological Motivation
[Online Reputation Management Services][1] from Interactive Bees (Online Reputation Management Company India) helps you to bring back a solid online presence. Online space is notorious for creating as well as destroying brands in a matter of no time. The Internet is a huge black hole that is impossible to fathom in terms of its influence. It works in mysterious ways and turns a brand out of dust and a brand into dust with its phenomenal reach. So you can get the best ORM services from us and present your company online with better status ...
[1]: https://www.reflektvisual.com/online-reputation-management-services/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
