Suggested problems

Vidalista 20 reviews

Dec. 29, 2020, 10:20 a.m. by Jaime_Corbett

Biological Motivation

In this world, there are many people who have a sexual problem like erectile dysfunction, and the reason this problem is reduced is because the blood vessels are blocked. To solve the ED problem first read the instruction on vidalista tablet and then use it for your convenience vidalista 20 review are also provided by many pharmacy.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21