Dec. 26, 2020, 7:12 a.m. by david230
Biological Motivation
We don’t believe that a research paper help service should ever provide a student with just any college assignment assistance. This choice should be up to you! With us you are in control. You tell us how you want your college assignment to be done and we listen to all instructions and work on the paper according to them.
Visit: https://www.gotoassignmenthelp.com/research-paper-help/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21