Suggested problems

Help Dark mode feature in Yahoo Mail? Dial helpline Yahoo Mail Customer Service number.

Dec. 21, 2020, 4:47 a.m. by alejandraleo

Biological Motivation

Around evening time you can have issues with the brilliance of the mail administration's UI. You can use dull mode in Yahoo Mail and if you face an issue to enable the faint mode, by then you can get to [Yahoo mail customer service][1]. If that doesn't empower, by then feel to permitted to visit the districts that give examining courses of action, for instance, help objections. ...

[1]: https://www.customer-carenumber-usa.com/yahoo-customer-service/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21