Suggested problems

For what reason could the Cash app direct deposit not post?

Dec. 21, 2020, 4:46 a.m. by alejandraleo

Biological Motivation

Once in a while, it might happen that your [Cash app direct deposit][1] not posted as you need. Along these lines, in this situation, you need to hang tight for a couple of days in light of the fact that occasionally it might take a couple of days to clear the exchange. It may happen if there is any occasion. On the off chance that you actually confronting the equivalent, at that point get in touch with us.

[1]: https://www.cashapphelp.net/blog/cash-app-direct-deposit/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21