Suggested problems

A Rapid Introduction to Molecular Biology

Figure 1. A 1900 drawing of onion cells at different stages of mitosis by Edmund Wilson.

Making up all living material, the cell is considered the building block of life. The nucleus, a component of most eukaryotic (nonbacterial) cells, has been known to be the hub of cellular activity for 150 years. Seen under a light microscope, the nucleus appears to simply be a darker region of the cell, but as we increase magnification, we find a hodgepodge of substances in the nucleus, which undergoes a flurry of activity leading up to and during mitosis, or cell division; see Figure 1.

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Connecting a printer over a USB cable is pretty easy. But connecting a wireless printer can become very challenging quite often. Follow the HP wireless printer setup process to install it in no time.

1. Take the printer out of the box and remove all tapes from it before starting.
2. Plug in the power cord, turn on the printer and install the print cartridges. Allow your printer to complete its startup routine, which includes printing of an alignment page (if applicable).
3. Go to the manufacturer's website and download drivers for your printer model.
4. Install the drivers and follow the instructions during hp wireless printer setup process.
5. In the meantime, go to printer's control panel and use wireless printer setup wizard.
6. Identify your wifi network and connect the printer to it using its correct credential.
7. Complete the wireless printer setup process by connecting to your printer model as it would appear during installation.

For more detailed information visit: https://mchelperprintersupport.com/hp-wireless-printer-setup/

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21