Suggested problems

Include in SELECT a column that isn't actually in the database

Dec. 18, 2020, 2:25 p.m. by kiransam

Biological Motivation

I'm attempting to run a SELECT statement that includes a column of a static string value. I have done this in the Access, but never with raw SQL.

I'm pursuing [Data Analytics training in hyderabad][1], you will get to learn several analytics tools, like MS Excel, Tableau, SAS, etc. Also, in Data Analyst courses in hyderabad, we will make sure you job-ready by preparing you for job interviews, helping you create an industry-grade resume, and more. So, give yourself a room in the Data Analytics career by signing up for this course today.

[1]: https://intellipaat.com/data-analytics-course-hyderabad/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21