Suggested problems

Conatct Reflekt Visual for Web development & Design with IOS/Android and Complete Digital Marketing service

Dec. 15, 2020, 9:55 a.m. by Reflekt Visual

Biological Motivation

Contact Reflekt Visual for [Web development in Bhubaneswar][1], Web Design, SEO, Mobile App Development, and Complete Digital Marketing service with 100% results. Call +91-8368604071 to get instant response and Auditing for your business.

[1]: https://www.reflektvisual.com/contact-us/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21