Suggested problems

Hyderabad Escort || Hyderabad Escort Agency

Dec. 14, 2020, 7:11 a.m. by nextlevel

Biological Motivation

If you are looking for escort services then this is the perfect place for you. We at Hyderabad Escort Agency take full care of your choice.

[Hyderabad Escort,][1] [Hyderabad Escort][2] , [Hyderabad Escort][3] , [Hyderabad Escort,][4] [Hyderabad Escort][5] [Hyderabad Escort][6] , [Hyderabad Escort ,][7] [Hyderabad Escort ,][8] [Hyderabad Escort ,][9] [Hyderabad Escort][10] [Hyderabad Escort][11] , [Hyderabad Escort ,][12][Hyderabad Escort][13] [,Hyderabad Escort][14] , [Hyderabad Escort][15] [Hyderabad Escort][16] [Hyderabad Escort ,][17] [Hyderabad Escort ,][18] [Hyderabad Escort][19] [,Hyderabad Escort][20]

[1]: https://www.hyderabadescortservices.in/ [2]: https://www.hyderabadescortservices.in/escorts-banjara-hills [3]: https://www.hyderabadescortservices.in/escorts-hitech-city [4]: https://www.hyderabadescortservices.in/escorts-madhapur [5]: https://www.hyderabadescortservices.in/escorts-kondapur [6]: https://www.hyderabadescortservices.in/escorts-gachibowli [7]: https://www.hyderabadescortservices.in/escorts-somajiguda [8]: https://www.hyderabadescortservices.in/escorts-punjagutta [9]: https://www.hyderabadescortservices.in/escorts-ameerpet [10]: https://www.hyderabadescortservices.in/escorts-begumpet [11]: https://www.hyderabadescortservices.in/escorts-paradise [12]: https://hyderabadescorts9347773494.blogspot.com/2020/12/what-do-you-know-about-hyderabad-escorts.html [13]: https://www.hyderabadescortservices.in/escorts-banjara-hills [14]: https://www.hyderabadescortservices.in/escorts-hitech-city [15]: https://hyderabadescorts9347773494.blogspot.com/2020/12/what-do-you-know-about-hyderabad-escorts.html [16]: https://www.hyderabadescortservices.in/escorts-punjagutta [17]: https://www.hyderabadescortservices.in/escorts-ameerpet [18]: https://www.hyderabadescortservices.in/escorts-somajiguda [19]: http://%20https://www.hyderabadescortservices.in/escorts-gachibowli [20]: https://www.hyderabadescortservices.in/escorts-madhapur

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21