Suggested problems

Which is best app store optimization services

Dec. 9, 2020, 10:18 a.m. by Reflekt Visual

Biological Motivation

App Store Optimization(ASO) is the process of optimizing a game or application to maximize its search visibility when a user searches in an App Store. The primary goal of App Store Optimization is to increase downloads and the number of loyal users. So you can get lots of benefits through the [best app store optimization services][1].

[1]: https://www.reflektvisual.com/app-store-optmization/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21