Suggested problems

Easiest Way To Play Word Games

Dec. 8, 2020, 11:49 p.m. by trimmer

Biological Motivation

Wordscapes is an enjoyable game that usually requires that you develop words together with your fingertips by simply joining and swiping characters within the appropriate sequence. The game is mainly a mix of reasoning as well as perception. You have to make usage of the two sensory faculties in order to resolve the puzzles since your perception and sound abilities do not truly permit you to resolve the puzzle without reasoning. Each and every stage is made up of 3 rings with phrases on them. At the start of every level, you are offered a variety of words which is to be utilized to form a word that is the same as the ones you have simply just completed, or perhaps attempt at it. This game is free to spend time playing and is extremely fun. You can also play it online for free. The video games are quite addicting nevertheless simultaneously the workings of the game are pretty straightforward. Wordscapes Answers and Wordscapes Cheats tend to be video games that have turned out to be hugely well-known over the last ten years. The Wordscapes game was created by German programmer Christian Reichelt and was released during the early nineties. As is typical with many of the puzzles which are built to be played with a pc screen, you can discover Wordscapes Answers and Cheats online in a number of forms. You can find variations of this video game that have an individual match character from a specific set of terms. Every term has a matching letter which is displayed on the display. Wordscapes are frequently advised by puzzle aficionados who wish to practice their own puzzle-solving capabilities or people who desire to enhance their terminology. It is because the puzzle is very easy and even for novices it's not tough to fix. The most typical reason for using the game would be to exercise your puzzle-solving capabilities and also to enhance your vocabulary and knowledge about the English language. There are numerous variations of the video game available and you can find them on-line, several of which for free, nevertheless other variations can be found as a premium service. Before making use of any of the puzzle games obtainable online, it is vital that you are taking time and energy to check out the software used by the website prior to buying it. Wordscapes is available in two types: a free edition and a premium version. The free edition contains the standard rules of the online game, and this edition does not have any of the characteristics of the premium version. This edition is great for those who don't wish to pay for the video game. The paid edition is a lot more effective and features several advanced features like a time assault setting and a stage editor, among others. If you're searching for Wordscapes daily puzzles and Wordscapes puzzle answers, it will not be challenging to locate. By looking for Wordscapes levels or Wordscapes tips you should discover lots of web sites to help keep you busy. Search for https://wordscapesmate.com/ to see more details.

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21