Suggested problems

How to book united airlines reservations

Dec. 8, 2020, 1:47 p.m. by Mack Jonshon

Biological Motivation

Are you planning to take a break and fly to the pristine beaches of the US? If yes, you can book your flight with United Airlines.It offers the best deals in flights within a short time of your travel. To book the cheapest flights, you need to visit at the [United Airlines Reservations USA][1]. On booking a flight with airlines, you can also enjoy the unlimited offers and benefits it provides all round the year.

[1]: https://www.247customerservicenumber.com/airlines/united-airlines-reservations-phone-number/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21