Suggested problems

Needs naughty fun with Udaipur call girl |satisfy my needs then hit me

Dec. 5, 2020, 11:07 a.m. by Top Class Genuine Escorts Service Provider in Udaipur

Biological Motivation

We will provide you the ultimate Udaipur girlfriend experience. I have a great passion for sex and i will share this for gentlemen who want to share an intimate encounter with truly beautiful and elegant ladies. ![enter image description here][1]for full satisfaction incall or outcall service visit our website to book the Udaipur call girl.

https://www.ankita-sharma.biz/udaipur-escorts/

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21