Suggested problems

Experience exotic desire with naughty vasant kunj call girl ?

Dec. 5, 2020, 7:18 a.m. by Top Class Genuine Escorts Service Provider in Udaipur

Biological Motivation

We offer a new High-class mixed-blood Young Nice [Vasant Kunj call girl][1]. If you are into young Asian girls you are in luck, which is very sensual and affectionate with a perfect proportion figure, we promise you 100% satisfaction from our girl services.It's quick & easy Come book our Vasant Kunj girls.

![enter image description here][2]

[1]: http://poojaescorts.com/escort-service-in-vasant-kunj.html [2]: https://www.hostedredmine.com/attachments/thumbnail/389651/250

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21