Dec. 1, 2020, 10:17 a.m. by Halley Roberts
Biological Motivation
A number of people always have a query in their mind, why their Netgear router Orange Light is showing? Instead of green? [Netgear Router Orange Power Light][1] signifies that there is an issue with the connectivity with the internet or the ISP (internet service provider) or an issue related to the cable or the configuration. The LEDs perform different functions as the orange or amber will show that surely there is an issue which is stopping the router from functioning as in the way it performs normally. For any of the queries related to [Netgear Router Orange Light][2] connect with us anytime on our toll-free number +1-844-935-3936 or visit our website for more information.
[1]: https://routerfixiya.com/netgear-router-orange-light/ [2]: https://routerfixiya.com/netgear-router-orange-light/
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
