Suggested problems

office.com/setup

Nov. 28, 2020, 10:42 a.m. by alex fredman

Biological Motivation

HELOO GUYS I AM WEB DEVELOPER AND I WANT TO SHARE MY KNOWLEDGE ABOUT OFFICE SETUP AND INSTALLATION . SO VISIT MY SITE TO KNOW GET YOUR PROBLEMS SOLVED [https://ooffiice-setup.com][1]

...

[1]: https://ooffiice-setup.com

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21