Suggested problems

Garmin GPS Map Update Online | Toll Free No: +1 800 897 1857

Nov. 26, 2020, 8:29 a.m. by gpsupdateonline

Biological Motivation

Are you facing [Garmin GPS map update][1] issue? Getting frustrated with your Garmin device due to some technical fault or issues.? Call us anytime on our toll-free number for instant solution USA/UK/Canada: +1-800-897-1857. Go to our website for more information. https://bit.ly/379p0Pq

...

[1]: https://bit.ly/3keNdb7

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21