Nov. 26, 2020, 5:17 a.m. by Simone Watson
Biological Motivation
[enter link description here][1]Due to this pandemic the life of students get much affected as it directly give a harsh impact on the carrier of student, also school and colleges are closed, so the only way which is left for the study is [online live teaching software][2], Also there are not much great application for the students, student start getting bored during online lectures.
[1]: http:// [2]: https://www.appsquadz.com/live-classes-software-development
A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.
An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.
Given: A DNA string
Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
20 12 17 21
