Suggested problems

Biological Motivation

Hello [Amazon.com/mytv][1] – Amazon Prime is a paid membership which gives you membership to a huge scope of services: free quick delivery, boundless video, selective admittance to bargains, among others. visit our website [amazon.com/mytv][2]

  [1]: https://www.wwwamazncommytv.com/
  [2]: https://amazon-amazonmytv.com/

...

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21