Suggested problems

Biological Motivation

Find in-stock. [300 wsm ammo][1] at the best prices. Look no further for your .300 Winchester Short Magnum ammunition! We have all the best brands for your rifle at the best prices, ready to ship! Online shopping from a great selection of discounted 300 Winchester Short Magnum at FoundryOutdoors. Find many ammo calibers and gauges of ammo for your firearm. Order now & save big. We have all the best brands for your rifle at the best prices.

[1]: https://www.foundryoutdoors.com/collections/300-winchester-short-magnum-wsm-ammo

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21