Suggested problems

How To cure erectile dusfunction in men

Nov. 21, 2020, 1:30 p.m. by Sam Howard

Biological Motivation

Allegra is the brand name of fexofenadine, Aurogra is an oral tablet that contains 100mg of the active ingredient sildenafil citrate. This tablet is used for the treatment of erectile dysfunction in men. Erectile dysfunction is a medical condition where men are unable to produce or maintain an erection. Along with stimulation, Aurogra helps fill the penis with blood by relaxing the muscles in blood vessels and increasing blood flow to the penis which then leads to an erection. Note that this drug will not produce an erection without the help of stimulation. Aurogra accelerates an adequate erection. Consumption of this pills is the most ideal approach to treat ED. It helps man get stronger erection . But , it is important for a man to stay aroused for the effect of this medicine to work . it helps him get erection for four to sic hours easily .https://www.martcastle.net/aurogra.html

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

An example of an DNA string (whose alphabet contains the symbols A, C, G, and T) is ATGCTTCAGAAAGGTCTTACG.

Given: A DNA string $s$ of length at most 1000 nucleotides.

Return: Four integers corresponding to the number of times that the symbols A, C, G, and T occur in $s$.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21